Hey Mum, I’m Famous!!! April 28, 2013
Posted by mwidlake in Private Life, Uncategorized.Tags: private
6 comments
I got a mail this week from Richard Harrison:
“Hi Martin
See you made it in to oracle magazine this month.That’s the pinnacle of any oracle professionals career – all downhill from here on in
“
I was not aware of my sudden raise to fame, but Richard is right – I’m in this month’s “peer to peer” section, which just gives some details about recent Oracle Ace’s I think. I’d forgotten that I had done a form they sent me before Christmas, answering a set of questions. It is interesting to see what they picked out of all my answers to include.
I think most of us would feel it is nice to see something about ourselves in print (so long as it is not derogatory or critical, of course!), though when I come to think of it, I don’t really know why it is nice – other than the rather self-serving feeling of having our egos polished. And as my friends I drink with would (and probably will) comment, my ego certainly does not need much polishing
. I’ve of course made it worse by blogging about how famous I now am. Polish, polish, polish.
Don’t worry, my wife stepped in to put me back in my place. “You could tell your mum when you next ring her – not that she’ll be impressed at all!”. Thanks wife. She’s right. My mum will just say “that’s nice” in a tone that in no way convinces me she means it, and will then proceed to talk at me about her new cats, what’s on TV and all the terrible things going on in the world, according to the “Daily Mail” (An utterly horrible and vacuous daily tabloid paper her in the UK).
So thank you for the heads-up Richard. I’m looking forward to the rapid decline of my career as you predict…
Re-forming the Martin Cluster in Norway April 5, 2013
Posted by mwidlake in Friday Philosophy, Meeting notes, Presenting, Uncategorized.Tags: Meeting, perception, Presenting
7 comments
Later this month, on April 17-20th, I am presenting again at the Norwegian Oracle user group (OUGN) spring conference {modern browsers will allow you to translate any Norwegian if you need to} . I loved it last year, as you can see from my third-day post on it. I’ve been lucky to attend some very good conferences over the last few years but those three days at the OUGN conference last year were, I think, my favourite single event to date. If you are within striking distance of Oslo and can negotiate the time out of the office, I would strongly recommend the event. If you can’t negotiate the time, heck, take a holiday and go anyway
Part of what I really enjoyed about the event was the fact that two of the days are spent on a ferry/cruise ship from Oslo to Kiel and back. And oddly enough, that is what initially put me off going to the conference – I am very susceptible to Sea Sickness. I had no problems though, partly due to the large quantities of travel calm pills I swallowed, partly due to the good weather, but mostly because the talks were excellent and the atmosphere was fantastic. I don’t mean “hey, it was a bit like a holiday” {though in some ways it was as it was such fun} but because the speakers and the attendees can’t escape, at least not without a long swim, everyone is around all day and all evening. It just adds to the whole event. I spoke to more “new” people during that conference than I ever have before.
At most conferences the presentations at the end of the day tend to be less well attended and there can be a feeling of wind-down, especially on the last day. A fair number of people feel the need to make an early exit to get home before the worst of the traffic or are under pressure to get back to the office and just sort out some issue that is pressing. The people around in the evening tend to be the presenters and the conference die-hards and so are usually the same sad old bunch of geezers and gals
. However, on the OUGN Boat this is not the case. All sessions tend to be well attended and in the evening nearly everyone is out having something to eat, a few drinks (those North Europeans sure do like the odd drink, but in a relaxed and affable way) and just being sociable.
Over the last few years the conference has developed a reputation for being technically strong too. This is of course partly due to the excellent atmosphere attracting good presenters and the good presenters in turn help make the conference better. popular and well attended – and that in turn attracts presenters. A nice positive feedback loop. I certainly learnt a lot of stuff last year and I cannot think of a poor presentation that I attended. Hmm, maybe one of mine was a little weak
. The organisers do an excellent job of helping the presenters feel relaxed and appreciated too. For example, I was nervous about the boat part of the trip to they gave me one slot on the mainland the day before we sailed and suggested I could bail out at Kiel if I was suffering. As a presenter, that sort of consideration counts for a lot. I don’t want or expect to be treated like some minor celebrity and I was not, but for the whole conference I just felt like the organisers appreciated my taking time out from work and flying out to come and present.
The final reason I am looking forward to the event (and thus the odd title) is the re-forming of the Martin Oracle Cluster
– this is myself, Martin Nash and Martin Bach. We all do several conferences a year, we all used to go along to the London Oracle Beers and we have become good friends. Other Oracle Martin’s are welcome to join us – At the OUGN last year there was also Martin Büchi, who I had not met before, but this year I think we are the only Martins presenting. We just don’t seem to have managed to re-from the cluster for many months now, partly as Mr Bach returned to Germany.
Martin Nash – Martin Büchi – Martin Bach – Martin Widlake
Thanks to Øyvind Isene for the picture.
I suppose I should mention what I am presenting on? Well, as I mentioned in my last Friday Philosophy, I am concentrating more on introductory presentations. You can see my official agenda here. I am doing:
- an introductory presentation on Row Level Security, VPD and hiding rows or columns of data {it will be interesting to see how large the audience is for that one!}
- an introduction to SQL tuning where I cover the absolute basics, but hopefully in a way that allows those new to it (or maybe even not so new) to treat tuning as a logical and sensible process, as opposed to Black Magic of favourite hints and arcane practices
- my disasters talk. I love giving my disasters talk. I’ve “been in the vicinity” of a lot of disasters and I only ever talk about things I have seen first hand, so no urban myths.
And so the evenings start drawing out (honest!) December 13, 2011
Posted by mwidlake in Uncategorized.1 comment so far
I know I’ve blogged about this before, but it was early on when very few people read my ramblings, so I am mentioning it again…
For those of us in the Northern Hemisphere, today is the day when the evenings start drawing out, which personally I find a relief as going home in the dark depresses me. Sunset tomorrow will be later than today – by all of a few seconds but, heck, later is later. {If I am out by a day, please don’t tell me – don’t shatter my good mood!}
However, as many of you are probably thinking, shortest day in the Northern hemisphere is not until the 22nd December (it’s the 21st or 22nd, depending on how long ago the last leap year was). Mornings continue to get later until around the 3rd January. It is because the earth is not “standing totally upright” in it’s orbit. If you think of the plane in which the earth circles around the sun as a flat surface, the north pole is at the top of the planet and that there is a pole sticking though the earth that it spins around every day, that pole is leaning back away from the sun today and slightly to one side, like a staggering drunk.
For the timing of sunrise and sunset for the city nearest you, check out this nice website here. This link will show London but you can change that.
The original post is here. It does not say any more but there are a couple of pretty sunset pictures on it.
Of course, if you are in the Southern Hemisphere {say Perth, Australia} then your sunrises have just started getting later by today. But time for the Barby in the evening is still drawing out for a week or two. We can all be happy
Was the Oracle UK logo Blue back in 1991? December 6, 2011
Posted by mwidlake in history, Uncategorized.2 comments
I think I might be going mad. I was sure that when I joined Oracle UK back in 1991 that the massive “Oracle” sign above the main office on “The Ring” in Bracknell was blue. It was the building that looked like a load of cubes balanced on each other.
As I remember it, the office stationary had “Oracle UK” on it in blue and my business cards were similarly coloured. I can’t find any 20 year old stationary to prove it and I owe Bryn Llewellyn a bottle of wine if I turn out to be wrong.
I’m sure I also remember fellow consultants joking in around 1993, when the annual bonus was particularly poor, that it was due to all the money spent going from blue to red stationary and signs when our UK identity was absorbed into the parent beast…
IOT Part 5 – Primary Key Drawback – and Workaround August 17, 2011
Posted by mwidlake in Architecture, development, performance, Uncategorized.Tags: Architecture, design, index organized tables, IOT, performance
18 comments
<..IOT1 – the basics
<….IOT2 – Examples and proofs
<……IOT3 – Significantly reducing IO
<……..IOT4 – Boosting Buffer Cache efficiency
……….>IOT6a – Slowing Down Insert
…………>IOT6(B) – OLTP Inserts
One of the drawbacks of IOTs is that they have to be organised by the primary key of the table. If your table does not have a primary key, it cannot be Index Organized.
I would argue that any table that holds persistent data (ie it is not transient data about to be loaded into the database proper or a temporary working set) should have a Primary Key. If I am working on a system and come across a table without a Primary Key I immediately challenge it. {There are occasional, valid reasons for a persistent table to lack a PK, but I confess I am struggling right now to come up with one – but I digress}. I’m a big fan of database-enforced referential integrity.
The problem is, if you you are making a table into an Index Organized Table so that the records are clustered to match how you process the data, it could well be that the primary key is not related to how you want to order the data. Let me give you an example. {Oh, and for brevity, I’ll put the SQL statements to create the examples at the end of this post}.
mdw11> desc ACCOUNT Name Null? Type ----------------------------------------------------- -------- ---------------------- ACCO_TYPE NOT NULL NUMBER(2) ---PKK ACCO_ID NOT NULL NUMBER(10) ---PK NAME NOT NULL VARCHAR2(100) DATE_1 NOT NULL DATE NUM_1 NUMBER(2) NUM_2 NUMBER(2) mdw11> desc TRANSACTION_HEAP Name Null? Type ----------------------------------------------------- -------- ---------------------- TRAN_TYPE NOT NULL NUMBER(2) ---PK TRAN_ID NOT NULL NUMBER(10) ---PK ACCO_TYPE NOT NULL NUMBER(2) ACCO_ID NOT NULL NUMBER(10) CRE_DATE NOT NULL DATE VC_1 NOT NULL VARCHAR2(100) DATE_1 DATE NUM_1 NUMBER(2) NUM_2 NUMBER(2)
This is a classic parent-child relationship, each account has a set of transactions. I’ve expanded on my prior example by:
- changing the parent to be called ACCOUNT and giving it a two-part Primary Key, ACCO_TYPE and ACCO_ID.
- Changing the child to be called TRANSACTION and given it a Primary Key of TRAN_TYPE and TRAN_ID.
- In a real system I would create a foreign key from TRANSACTION.ACCO_TYPE,ACCO_ID to the ACCOUNT table primary key.
Note that the Primary Key on the TRANSACTION table is NOT based on the account columns. Maybe in theory the primary key on the transaction table would be the account columns and the cre_date – if the cre_date held a datetime AND two records could not be created on the same second. If we used a timestamp then you might be able to argue no record would be created in the same fraction of a second – except that often transactions get given a fixed time. Midnight springs to mind (consider when you would add the accrued interest on a savings account). So, a new surrogate Primary Key is intoduced, a transaction type and ID. TRAN_TYPE and TRAN_ID are the primary key of the TRANSACTION table.
I’d say that I see such two-part primary keys more often then single column primary keys these days. Possibly because so many databases receive information from other systems or even applications on the same database.
As before, I create 10,000 parent records (ACCOUNT) and 10,000 random child records (TRANSACTION_HEAP) each day for 100 days.
Also as before, I want to select information grouped by account. I want all the transactions for an account, not all transactions on a day or for a range of transaction IDs. Hopefully this is a scenario most of you will recognise.
Selecting a sum of one of the non-indexed columns and a count of records for a given account takes quite a bit of effort on the part of the HEAP table:
select sum(num_1), count(*) from transaction_heap th where acco_type=10 and acco_id=123
SUM(NUM_1) COUNT(*)
---------- ----------
1201 116
Elapsed: 00:00:02.68
Execution Plan
---------------------------------------------------------------------------------------
| Id | Operation | Name | Rows | Bytes | Cost (%CPU)| Time |
---------------------------------------------------------------------------------------
| 0 | SELECT STATEMENT | | 1 | 10 | 3466 (1)| 00:00:52 |
| 1 | SORT AGGREGATE | | 1 | 10 | | |
|* 2 | TABLE ACCESS FULL| TRANSACTION_HEAP | 100 | 1000 | 3466 (1)| 00:00:52 |
---------------------------------------------------------------------------------------
Statistics
----------------------------------------------------------
0 recursive calls
0 db block gets
13929 consistent gets
13921 physical reads
Of course, it has to do a full table scan as my Primary Key is on two columns that have nothing to do with the query. I can repeat this statement as often as I like, it takes the same number of physical reads and consistent gets as it is not caching the information.
I add an index on the ACCO_TYPE, ACCO_ID and CRE_DATE columns and re-run the query:
select sum(num_1),count(*) from transaction_heap th where acco_type=10 and acco_id=123
SUM(NUM_1) COUNT(*)
---------- ----------
1201 116
Elapsed: 00:00:00.01
Execution Plan
---------------------------------------------------------------------------------------------------
| Id | Operation | Name | Rows | Bytes | Cost (%CPU)| Time |
---------------------------------------------------------------------------------------------------
| 0 | SELECT STATEMENT | | 1 | 10 | 103 (0)| 00:00:02 |
| 1 | SORT AGGREGATE | | 1 | 10 | | |
| 2 | TABLE ACCESS BY INDEX ROWID| TRANSACTION_HEAP | 100 | 1000 | 103 (0)| 00:00:02 |
|* 3 | INDEX RANGE SCAN | TRHE_ACCO_CRDA_IDX | 100 | | 3 (0)| 00:00:01 |
---------------------------------------------------------------------------------------------------
Statistics
----------------------------------------------------------
0 recursive calls
0 db block gets
120 consistent gets
0 physical reads
I ran it twice to get rid of the parse overhead, but the first time it did a load of physical reads to support those 120 consistent gets.
I could recreate the TRANSACTION_HEAP table as an IOT of course – but it will be organized by the TRAN_TYPE and TRAN_ID columns. That is useless to me. Even if I add a secondary index on the ACCO_TYPE, ACCO_ID and CRE_DATE columns it will at best be no better than the above HEAP table and, because the secondary index will hold rowid guesses and will sometimes have to use the primary key information to walk down the index, it will be worse. {I am not sure I have explained that bit yet about row guesses. Post 6?}
So, if you want the information organized in an order that is not helped by the Primary Key of the table, an IOT is useless to you. You cannot achieve that physical record grouping by the IOT method.
I am going to do something else though. I’m going to sort of change the rules to work around the issue.
As far as the physical implementation is concerned, a Primary Key is in effect just a unique index and two rules. The rules are that all the columns in the Primary Key must be mandatory and there can only be one PK on a table. I can have as many unique indexes as I like, so long as the key combinations lead to no duplicate rows. I can alter my Primary Key – it is not set in stone.
Before I go any further I am going to stress that I am about to abuse the concept of the Primary Key. I’d need to do a seperate blog to fully justify saying what a Primary Key is, but part of the concept is that no column must be derivable from other columns in the PK and it must be the minimum number of columns required to make the key unique.
We want to group the data by the account columns and the creation date. So let’s define a Primary Key that is ACCO_TYPE, ACCO_ID, CRE_DATE and whatever else we need to guarantee the key is unique. In our case that would be TRAN_TYPE and TRAN_ID – the current Primary Key! If I knew I would always want all records for the account, I could drop the CRE_DATE out of my fake Primary Key, but I know that the creation date is very often important. You may want activity for the last month, last quarter, a stated date or even an exact datetime. For all those cases, including the CRE_DATE column is highly beneficial.
So, I create TRANSACTION_IOT below and populate it with data.
desc transaction_iot
Name Null? Type
----------------------------------------------------------- -------- --------------
TRAN_TYPE NOT NULL NUMBER(2)
TRAN_ID NOT NULL NUMBER(10)
ACCO_TYPE NOT NULL NUMBER(2)
ACCO_ID NOT NULL NUMBER(10)
CRE_DATE NOT NULL DATE
VC_1 NOT NULL VARCHAR2(100)
DATE_1 DATE
NUM_1 NUMBER(2)
NUM_2 NUMBER(2)
--
--
OWNER TABLE_NAME NUM_ROWS BLOCKS AVG_L GLS ULS LST_ANL PRT SAMP_SIZE
-------- -------------- ------------- ----------- ----- --- --- ------------ --- ----------
MDW TRANSACTION_IO 1000,000 94 YES NO 160811 23:05 NO 1000000
T
INDEX_NAME TYP PRT UNQ BL L_BLKS DIST_KEYS CLUSTF LB_KEY DB_KEY LST_ANL
--------------- --- --- --- -- ---------- ----------- ------------ ---------- ---------- ------------
TRIO_PK IOT NO UNI 2 21,433 1058,381 0 1 1 160811 23:05
TRIO_TRAN_UQ NOR NO UNI 2 4,386 1000,000 999,405 1 1 160811 23:05
INDEX_NAME TABLE_NAME PSN COL_NAME
---------------------------- ---------------- --- ------------------------------------------------
TRIO_PK TRANSACTION_IOT 1 ACCO_TYPE
TRIO_PK TRANSACTION_IOT 2 ACCO_ID
TRIO_PK TRANSACTION_IOT 3 CRE_DATE
TRIO_PK TRANSACTION_IOT 4 TRAN_TYPE
TRIO_PK TRANSACTION_IOT 5 TRAN_ID
TRIO_TRAN_UQ TRANSACTION_IOT 1 TRAN_TYPE
TRIO_TRAN_UQ TRANSACTION_IOT 2 TRAN_ID
Now let’s select our data from that IOT.
select sum(num_1),count(*) from transaction_IOT th where acco_type=10 and acco_id=123
SUM(NUM_1) COUNT(*)
---------- ----------
1030 97
Elapsed: 00:00:00.00
Execution Plan
-----------------------------------------------------------------------------
| Id | Operation | Name | Rows | Bytes | Cost (%CPU)| Time |
-----------------------------------------------------------------------------
| 0 | SELECT STATEMENT | | 1 | 10 | 5 (0)| 00:00:01 |
| 1 | SORT AGGREGATE | | 1 | 10 | | |
|* 2 | INDEX RANGE SCAN| TRIO_PK | 100 | 1000 | 5 (0)| 00:00:01 |
-----------------------------------------------------------------------------
Statistics
----------------------------------------------------------
0 recursive calls
0 db block gets
5 consistent gets
0 physical reads
5 consistent gets. It has walked down the IOT and scanned 3 blocks to collect that data. Our IOT based on an abused Primary Key does the job of supporting range scans efficiently, with the benefits to the Block Buffer Cache I refered to in IOT4
That “Primary Key” I created is NOT a real Primary key. It is not the minimum number of columns I need to uniquely identify a column. My Primary key is on ACCO_TYPE, ACCO_ID, CRE_DATE,TRAN_TYPE and TRAN_ID – the account, the datetime of the transaction and the transaction. What if I was to alter the datetime by a second? I could create a record with the same account, the same transaction_id as an existing record but a second into the future. That is just wrong. After all, the whole point of the TRAN_TYPE and TRAN_ID is to uniquely identify a record. If created the new record I stated above, there would be two records for the one TRAN_TYPE/TRAN_ID.
I protect against this ability to create incorrect records by creating a UNIQUE KEY against the table also, against columns TRAN_TYPE and TRAN_ID. This is unique index TRIO_TRAN_UQ as displayed in the information above. A Primary Key is usually the referenced parent of any referential integrity, ie foreign keys, between this table and any children. However, a Unique Key can also be the target of Referential Integrity. I cannot create a record in TRANSACTION_IOT with the same TRAN_TYPE/TRAN_ID as already exists due to this unique constraint:
insert into transaction_iot_p values (2,163 -- existing transaction type and id ,10,11111 ,sysdate,'ASCAFWEWEHGWSHERJH',SYSDATE,7,7) / insert into transaction_iot_p * ERROR at line 1: ORA-00001: unique constraint (MDW.TIP_TRAN_UQ) violated Elapsed: 00:00:00.34
So, I have my IOT to support querying code and I have my Unique Constraint to police my original Primary Key and be used as the target for any Foreign Key requirements I might need. This is not a perfect solution – the design will look a little strange to anyone who looks at this database and the Unique Key is supported by a secondary index on an IOT which can have some issues. But it does work.
My “primary key” is no longer a true Primary Key. It is just a tool for allowing me to organise the data physically in a way that will support my application. That is what I meant about changing the rules.
I am willing to abuse a Primary Key in this way because of the performance benefits. It is a solution for a system where most of the query access is against a set of records which would be scatter-gunned across a table if you did not use some sort of physical grouping. If you are reading this and thinking “oh, I am not sure about you doing that to a Primary Key Martin” then you are probably OK to consider this solution. If you can’t see a problem with it then you are either very used to turning off referential integrity and understand the consequences – or you simply do not understand what RI does for your database. If you are in the latter camp, do not even consider doing this. If you are one of those people who works on data warehouse and for whom is it just part of the DW process to turn off RI as that is what you do for data warehouses – DON’T do this!
OK, I’m nearly at the end of this topic but I want to touch on partitioning. You can range partitition an Index Organized Table from 9i I think. It is certainly supported in Oracle 10 upwards. Partitioning is important in this technique because a unique index must contain the partition key if the index is to be locally partitioned – otherwise the index must be global, ie the one index object references all the partitions across the table.
Below is my table creation statement for the IOT organized by the account, creation date and transaction. The table is ranged partitioned by CRE_DATE, into months.
create table transaction_IOT_P
(tran_type number(2) not null
,tran_id number(10) not null
,acco_type number(2) not null
,acco_id number(10) not null
,cre_date date not null
,vc_1 varchar2(100) not null
,date_1 date
,num_1 number(2)
,num_2 number(2)
,constraint tip_pk primary key(ACCO_TYPE,ACCO_ID,CRE_DATE,TRAN_TYPE,TRAN_ID)
-- using index tablespace index_01
,constraint tip_tran_uq unique (TRAN_TYPE,TRAN_ID)
using index tablespace index_01
)
organization index
tablespace data_01
partition by range (cre_date)
(partition rm20110601 values less than (to_date('01-06-2011','DD-MM-YYYY'))
tablespace data_01
,partition rm20110701 values less than (to_date('01-07-2011','DD-MM-YYYY'))
tablespace data_01
,partition rm20110801 values less than (to_date('01-08-2011','DD-MM-YYYY'))
tablespace data_01
,PARTITION RMTOP VALUES LESS THAN (MAXVALUE)
tablespace USERS
)
/
You can see the definition of my fake Primary Key and the fact that it does not have a tablespace defined for it – as the ‘organization index’ statement lower down causes the table to be an IOT and the segment will go into the “table” tablespace.
I then state my Unique Index to police the integrity of my table – TIP_TRAN_UQ
I then state the partition clause, ‘partition by range (cre_date)’ followed by my initial partition definitions. It’s as simple as that to partition an IOT.
What gets created? A set of four segments for the IOT, which are primary key index segments of course, not table segments:
@seg_dets
Enter value for seg_name: tip_pk
Enter value for owner: mdw
OWNER SEG_NAME SEG TS_NAME BYTES_K BLOCKS exts INI_K NXT_K
-------- --------------- --- -------- ---------- --------- ---- ------- -------
MDW TIP_PK RM201106 IP DATA_01 45,056 5,632 59 64 1024
01
MDW TIP_PK RM201107 IP DATA_01 60,416 7,552 74 64 1024
01
MDW TIP_PK RM201108 IP DATA_01 61,440 7,680 75 64 1024
01
MDW TIP_PK RMTOP IP USERS 34,816 4,352 49 64 1024
Note that the SEG (type) is “IP” – my script decodes the type into a short mnemonic and IP is Index Partition. You can see the tablespaces those segments are in and the size of the segments. What about that unique index I created?
@seg_dets Enter value for seg_name: tip_tran_uq Enter value for owner: mdw OWNER SEG_NAME SEG TS_NAME BYTES_K BLOCKS exts INI_K NXT_K -------- --------------- --- -------- ---------- --------- ---- ------- ------- MDW TIP_TRAN_UQ IND INDEX_01 35,840 4,480 50 64 1024
It is a single segment, a normal index. I cannot have it as a locally partitioned index as it is a unique index and lacks the partitioning key in it’s definition.
This could be a problem. The usual reason you partition a table is because it is too large to comfortably be held as a single segment {and also for the benefit of partition exclusion, but you don’t usually need that on small tables!}. This means that the global index to support that primary key is going to be large. Now, I made a “mistake” when I created my partitioned IOT – I did not create a partition for this month, some data has gone into the MAXVALUE partition (see the size of the segment above, 34K and 49 extents). If I split that last partition to create a new partition for this month and a new MAXVALUE partition, I will invalidate the global index and I will have to rebuild it. Very large indexes can take a long time and a heck of a lot of temporary space to gather and sort the data. That could be an ongoing maintenance nightmare.
In a recent implementation I did using IOTs I did not create a global unique index to replace the original foreign key. I create a non-unique, locally partitioned index to support some queries using those columns and the table had no children so no Foreign Keys were needed. But there was something else I needed to do as I had removed the referential integrity rules for that table. Remember I sad I am a fan of database enforced referential integrity? Now I “know” the application will not create data that will break the removed Primary Key rule, I “know” I documented what I had done. And I know that in 12 months time there will almost certainly be data that will have duplicate values for that Primary Key if it is not enforced somehow, because it always happends. I need to implement a little script to regularly check for duplicate TRAN_TYPE/TRAN_ID conmbinations being created. If you remove RI from a relational database, you should replace it in some way. Otherwise, you will pretty soon have a non-relational database.
That’s it for this topic. The below is my example script for creating most of the above, in case anyone wants it or wants to verify what I have said.
-- test_iot2.sql
-- create test tables to show how you can work around the PK issue and
-- partition an IOt - and the possible impact on my PK workaround.
spool test_iot2.lst
--
set feed on timi on pause off
--
drop table account purge;
drop table transaction_heap purge;
drop table transaction_iot purge;
drop table transaction_iot_p purge;
--
-- create 10,000 parent records
create table mdw.account
(ACCO_type number(2) not null
,ACCO_id number(10) not null
,name varchar2(100) not null
,date_1 date not null
,num_1 number(2)
,num_2 number(2)
,constraint ACCO_pk primary key(ACCO_type,ACCO_id)
using index tablespace index_01
)
tablespace data_01
/
insert into account
select 10
,rownum
,dbms_random.string('U',mod(rownum,10)+50)
,sysdate-(mod(rownum,500)+1000)
,mod(rownum,99)+1
,trunc(dbms_random.value(0,100))
from dual connect by level <= 5000
/
insert into account
select 15
,rownum
,dbms_random.string('U',mod(rownum,10)+50)
,sysdate-(mod(rownum,500)+1000)
,mod(rownum,99)+1
,trunc(dbms_random.value(0,100))
from dual connect by level <= 5000
/
--
-- create the table to hold the children as a heap table
create table transaction_heap
(tran_type number(2) not null
,tran_id number(10) not null
,ACCO_type number(2) not null
,ACCO_id number(10) not null
,cre_date date not null
,vc_1 varchar2(100) not null
,date_1 date
,num_1 number(2)
,num_2 number(2)
,constraint trhe_pk primary key(tran_type,tran_id)
using index tablespace index_01
)
tablespace data_01
/
--
create index trhe_ACCO_crda_idx
on transaction_heap(ACCO_type,ACCO_id,cre_date)
tablespace index_01
/
-- populate the Heap table
-- 100 days, 10000 people
declare
v_num number :=10000; -- number of people
v_str varchar2(60);
begin
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
for i in 1..100 loop --days to do
v_str:=dbms_random.string('U',60);
insert into transaction_heap
(tran_type,tran_id,ACCO_type,ACCO_id,cre_date,vc_1,date_1,num_1,num_2)
select mod(rownum,3)+1
,((i-1)*v_num)+rownum
, 5+(trunc(dbms_random.value(1,3))*5)
,trunc(dbms_random.value(1,v_num/2))
,sysdate-(100-i) + (rownum/(60*60*24) )
,substr(v_str,1,51+mod(rownum,10))
,sysdate-(100-i) + ((mod(rownum,30)+1)/3)
,mod(rownum,20)+1
,mod(rownum,99)+1
from dual connect by level <=v_num;
end loop;
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
end;
/
--
--
--
create table transaction_IOT
(tran_type number(2) not null
,tran_id number(10) not null
,ACCO_type number(2) not null
,ACCO_id number(10) not null
,cre_date date not null
,vc_1 varchar2(100) not null
,date_1 date
,num_1 number(2)
,num_2 number(2)
,constraint trio_pk primary key(ACCO_type,ACCO_id,cre_date,tran_type,tran_id)
-- using index tablespace index_01
,constraint trio_tran_uq unique (tran_type,tran_id)
using index tablespace index_01
)
organization index
tablespace data_01
/
--
-- populate the IOT table
-- 100 days, 10000 people
declare
v_num number :=10000; -- number of people
v_str varchar2(60);
begin
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
for i in 1..100 loop --days to do
v_str:=dbms_random.string('U',60);
insert into transaction_IOT
(tran_type,tran_id,ACCO_type,ACCO_id,cre_date,vc_1,date_1,num_1,num_2)
select mod(rownum,3)+1
,((i-1)*v_num)+rownum
, 5+(trunc(dbms_random.value(1,3))*5)
,trunc(dbms_random.value(1,v_num/2))
,sysdate-(100-i) + (rownum/(60*60*24) )
,substr(v_str,1,51+mod(rownum,10))
,sysdate-(100-i) + ((mod(rownum,30)+1)/3)
,mod(rownum,20)+1
,mod(rownum,99)+1
from dual connect by level <=v_num;
end loop;
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
end;
/
create table transaction_IOT_P
(tran_type number(2) not null
,tran_id number(10) not null
,ACCO_type number(2) not null
,ACCO_id number(10) not null
,cre_date date not null
,vc_1 varchar2(100) not null
,date_1 date
,num_1 number(2)
,num_2 number(2)
,constraint tip_pk primary key(ACCO_type,ACCO_id,cre_date,tran_type,tran_id)
-- using index tablespace index_01
,constraint tip_tran_uq unique (tran_type,tran_id)
using index tablespace index_01
)
organization index
tablespace data_01
partition by range (cre_date)
(partition rm20110601 values less than (to_date('01-06-2011','DD-MM-YYYY'))
tablespace data_01
,partition rm20110701 values less than (to_date('01-07-2011','DD-MM-YYYY'))
tablespace data_01
,partition rm20110801 values less than (to_date('01-08-2011','DD-MM-YYYY'))
tablespace data_01
,PARTITION RMTOP VALUES LESS THAN (MAXVALUE)
tablespace USERS
)
/
-- populate the IOT_P table
-- 100 days, 10000 people
declare
v_num number :=10000; -- number of people
v_str varchar2(60);
begin
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
for i in 1..100 loop --days to do
v_str:=dbms_random.string('U',60);
insert into transaction_IOT_P
(tran_type,tran_id,ACCO_type,ACCO_id,cre_date,vc_1,date_1,num_1,num_2)
select mod(rownum,3)+1
,((i-1)*v_num)+rownum
, 5+(trunc(dbms_random.value(1,3))*5)
,trunc(dbms_random.value(1,v_num/2))
,sysdate-(100-i) + (rownum/(60*60*24) )
,substr(v_str,1,51+mod(rownum,10))
,sysdate-(100-i) + ((mod(rownum,30)+1)/3)
,mod(rownum,20)+1
,mod(rownum,99)+1
from dual connect by level <=v_num;
end loop;
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
end;
/
commit;
--
exec dbms_stats.gather_table_stats(ownname=>USER,tabname=>'ACCOUNT')
exec dbms_stats.gather_table_stats(ownname=>USER,tabname=>'TRANSACTION_HEAP')
exec dbms_stats.gather_table_stats(ownname=>USER,tabname=>'TRANSACTION_IOT')
exec dbms_stats.gather_table_stats(ownname=>USER,tabname=>'TRANSACTION_IOT_P')
--
select * from transaction_iot_p
where rownum < 10
/
insert into transaction_iot_p
values
(2,163 -- existing transaction type and id
,1,11111
,sysdate,'ASCAFWEWEHGWSHERJH',SYSDATE,7,7)
/
insert into transaction_iot_p
values
(3,163 -- new transaction type and id
,1,11111 -- but the whole of the rest of the record is the same.
,sysdate,'ASCAFWEWEHGWSHERJH',SYSDATE,7,7)
/
--
BEGIN
dbms_output.put_line (to_char(SYSTIMESTAMP,'HH24:MI:SS.FF'));
END;
/
--
spool off
What, me? An OakTable member? August 23, 2010
Posted by mwidlake in Uncategorized.Tags: Blogging, OakTable, user group
22 comments
The title rather gives it away, but I have been invited to become a member of the OakTable network. For anyone not aware of the OakTable, it is a group of some of the very best Oracle practitioners around and you would recognise many of the names in the group. Most of them also present at conferences around the globe and set up the Oak Table challenge at various of these venues, where they try and address any oracle-based question you might have.
All of them are very bright, all are very knowledgeable.
Which is where I come a little unstuck. Without wanting to sound like some vapid actor at a Hollywood award ceremony decrying “I am so unworthy of this nomination”, whilst secretly thinking “I so deserve this”… Well, my initial thought when receiving the invite was “I am so unworthy…”. I’ve had the weekend to think about it though. And I still think “I am so unworthy…”
I’m actually on record as suggesting that we might also need a “Formica Table”, though the only online reference to it I can now find {I MUST put my old presentations on my web site} is from the archives of Andrew Clark’s Radiofreetooting blog about a presentation I did at the UKOUG in 2007. {Follow the link and search for Widlake or Formica, it is way down the bottom}. If you can’t be bothered looking at the original, Andrew said this:
I was particularly taken with the Formica Table. This would be a forum where “not bad” DBAs answered questions which fitted 95% of all scenarios; sort of an Oak Table For The Rest Of Us.
I think his quote of me was actually better than the original. The idea was that the real experts on the Oak Table {is it actually one word guys? “OakTable”!?} deal with the hard, tricky, complex issues and this secondary formica table could deal with the rest of the world. Because I could just about cope with formica level. The intention being, of course, that I would sit on said plastic-laminate-coated-chipboard table.
Am I being falsely modest here? I do not think I am. I know I am good at what I do and I know I have achieved some impressive things. I also know most people who employ me ask me to stay longer (and I usually do). But I am realistic. I’m very good but I am not fantastic (at Oracle anyway
). And no way as capable as many OakTable members. But the people on the OakTable have some other things in common. From the home page of the website:
The OakTable network is a network for the Oracle scientist, who believes in better ways of administering and developing Oracle based systems.
The impression I get from spending some time with the handful of members of the OakTable that I already know is that they generally all feel that you need to not only be knowledgeable about Oracle (or whatever area of knowledge you are interested in) but you need to be able to demonstrate and show that the knowledge is real. You create test cases and try things out. Just saying “you should use a large block size for data warehouses” is just not really enough, it is so much more powerful if you can say why you think this is so and then produce test cases to show that. And if someone produces a test case to show the opposite, well you need to reconsider. It is what is at the core of the scientific method. You test things and have to adapt or change if the tests refute your theory. If someone will not provide test cases or real-world examples to support their facts, they are in fact, opinions. Which is fine, just don’t sell them as facts.
The other common thread is a willingness (and perhaps a worrying compulsion) to teach. I’ve seen many of the OakTable present and I know a lot of them do courses all over the globe. Sometimes it is paid work, often it is not, it is done as a benefit to the community. That is nearly always the case with user group presentations.
I’m figuring that is why I’ve been invited to join. Technically, most if not all the OakTable are a step or three better than me and I reserve my right to respect that. But I really believe in demonstrating what you think is going on with Oracle is what is really going on and I have an almost worryingly compulsive willingness to teach.
So, have I turned down the invite? Are you kidding!?! It’s great to be invited and I really look forward to having more to do with this bunch of talented and helpful people. And I am also looking forward to contributing my little bit to the group and, through it, to the wider Oracle community.
It is slightly ironic that I have been asked to join a group of people right now who are characterised by their willingness and drive to scientifically investigate and then disseminate information on Oracle-based technology when I have spent the last month doing nothing of the sort. I have been digging ditches, cleaning out ponds, chopping down trees and doing major DIY, all of which I am utterly unsuited to but I enjoy. So I now feel obliged to stop that, pick up a keyboard and continue to investigate the edges of my ignorance. I’ll try and keep you informed of progress.
Oh, and I have another problem now. How do I get the OakTable Icon onto this blog? Somewhere on the right I think…
Friday Philisophy – To Manage or to Not Manage March 26, 2010
Posted by mwidlake in Friday Philosophy, Management, Uncategorized.Tags: Management, rant
6 comments
Recently a friend of mine Graham Oaks blogged about his decision to step back from management and return to the Technical Coal Face.
I made a similar decision 3 or 4 years back, so I have a lot of empathy for his position and his decision. I found that to do the job of a manager takes up a lot more time, effort, patience and emotional effort than I had realised. Team leading is bad enough, having to coordinate the efforts of a half dozen people and sorting out the myriad issued they throw your way. Being in charge of multiple teams, responsible for strategy, dealing with staff development and moral, being a buffer against HR and having to deal with the politics created by people who WANT to be managers and wield power is more than a full-time job. Trying to hold onto a technical element as well, I found I could only manage it by doing the technical job as a “hobby”, in my own time. It was just too much to keep going year after year.
I had to chose. Give up the technical to give me enough personal resource to remain a manager and get better at it, or stop being a manager and start re-gaining my technical skills. I chose the latter.
Since I made my decision 3 years ago, I have met several people who have made the same conscious decision to step away from management and return to a more technical role. You may stand to earn more as a manager {which is something I objected to before being a manager and I still object to having been one – it should be possible to earn the same doing either} but for some of us it is not enough to make losing the hands-on work a sacrifice worth making.
One of the points Graham makes in his blog is that his spell as a manager has given him an appreciation of the challenges of management and the particular hells and stresses of the role. I think this is something that people who have never been managers have trouble really understanding.
I was working with a guy a couple of years ago and he was telling me how much of “a Moron” his boss was. In fact, he felt his current boss was even more of a moron than his previous boss. He then confessed that all of his bosses had been morons. “What, every single one of them?” I asked. Yes, absolutely all of them. That struck me as incredibly unfortunate, that every single one of these managers (and he’d had a lot as he moved between teams and positions on a regular basis), most of whom had come up through the technical ranks, were all Morons. I pointed out this unfortunate coincidence and wondered if there might actually be a common factor with all of these managers. He told me there was; They were all Morons.
He himself had never been a manager. He said he was too smart. Not smart enough to get what I was hinting at with the common factor suggestion though.
Obviously, some managers are poor at what they do; there are poor people in every job. But something I took away from my time being a manager is a lack of empathy for anyone saying all managers are a waste of time when they have never done the job themselves.
After all, I doubt there is any job where just doing it means you are an idiot.
Except Sys Admins – They are all idiots
(ducks behind server).
Friday Philosophy – Software being Good is not Good Enough February 5, 2010
Posted by mwidlake in Friday Philosophy, Uncategorized.Tags: behaviour, knowledge
4 comments
In a previous Friday Philosophy on In Case of Emergency I mention that something being simply a “Good Idea” with technology is not good enough. Even being a GREAT idea is not enough. It also has to be:
- Easy and simple to use. After all, using that funny stick thing behind your steering wheel in a car, to indicate which direction you are turning, seems to be too much of an effort for many people. If installing some bit of softare or running a web page is more than a little bit of effort, most people will not bother.
- Quick. No one has patience anymore, or spare time. This will probably be the fourth year in a row I do not plant any vegetables in our garden as I need to spend a day or two clearing and digging over the spot for said veg. You can’t beat home-grown veg. Similarly, I won’t use a web pages that takes as long to load as it does to plant a carrot seed.
- Known about. There could be a really fantastic little program Out There that allows you to take a screen shot, add a title and comment and pastes it straight into a document for you, converting to half a dozen common formats on the fly. But I do not know about it. { ScreenHunter is pretty good, I have to say, and when I have shown it to people a lot of them like it}.
- Popular. This is not actually the same as “known about”. For a stand-alone application to be good for you, you just need to know where it exists. Like maybe a free building architecture package. Whether thousands of people use it is moot, so long as you can get your extension drawings done in it with ease, that makes it great. But something that relies on the community, like a service to rate local eataries, unless lots of people use it and add ratings, well who cares. There are dozens (if not hundreds) of such community ”good ideas” started every day but unless enough people start to use it, it will fizzle out, as the vast majority of them do.
Point 4 is highly relevant to “In Case Of Emergency” as it is simple, quick and relativley known about. It just needs to be ubiquitous.
I became very aware of point 3 a few years ago and also of the ability for very clever people to be sometimes very stupid when it comes to dealing with their fellow humans.
I was working on a database holding vast quantities of DNA information. If you don’t know, DNA information is basically represented by huge long strings of A, C, T and G. So something like AACTCGTAGGTACGGGTAGGGGTAGAGTTTGAGATTGACTGAGAGGGGGAAAAATGTGTAGTGA…etc, etc, etc. These strings are hundreds, thousand, hundreds of thousands of letters long. And Scientists like to search against these strings. Of which there are millions and millions. Not for exact match mind, but kind-of-similar, fuzzy matches, where for example 95% of the ACTGs match but some do not. It’s called a BLAST match.
Anway, suffice to say, it takes a lot of compute power to do this and a fair amount of time to run. There was a service in America which would allow you to submit a BLAST query and get the answer in 20 minutes or so {I have no idea how fast it is now}.
Some extremely clever chaps I had the pleasure of working with came up with a faster solution. Same search, under 5 seconds. Now that is GREAT. We put together the relevant hadware and software and started the service. Now I thought it went beyond Good or even Great. It was Amazing (and I mean it, I was amazed we could do a fuzzy search against a billion such strings in 2, 3 seconds using a dozen or so PC-type servers).
No one used it. This was because almost no one knew about it and there was already this slow service people were used to using. People who used the old service never really thought to look for a new one and the chances were they would not have found ours anyway.
I pushed for more to be made of this new, faster service, that it should be advertised to the community, that it should be “sold” to people (it was free to use, by “sold” I mean an attempt made to persuade the scientific community it was worth their while investigating). The response I was given?
“If the service is worth using, people will come and use it”.
No they won’t. And indeed they didn’t. It was, I felt, a stupid position to take by an incredibly inteligent person. How were people to know it existed? Were they just supposed to just wake up one morning knowing a better solution was out there? The internet pixies would come along in the night and whisper about it in your ear? In the unlikely event of someone who would be interested in it just coming across it, were they then going to swap to using it? After all no one else seemed to know about it and it was 2 orders of magnitude faster, suspiciously fast, how could it be any good?
The service got shut down as it was just humming in the corner consuming electricity. No one knew it existed, no one found it, no one came. I can’t but help wonder how much it could have helped the scientific community.
There must be thousands of other “failed” systems across the IT world that never took off just because the people who could use it never knew it existed. Depressing huh?
Testing Methodology – Getting Community Information January 22, 2010
Posted by mwidlake in Testing, Uncategorized.Tags: knowledge, Testing
4 comments
<Last post I tried to highlight that knowing specifically what you want to understand before you start testing is important and that it is beneficial to start with the booring official documentation. This is so that you can filter what is Out There in the web, as well as get a good grounding in what is officially possible.
There is no doubt that you can get a lot more information on Oracle features from the community than you can from the manuals and that it is often presented in a more easily understood and relevant way. But some of it is not right for your version or is just plain wrong. I can do no better than to refer to this recent posting by Jonathan Lewis on the topic. In this case, it is the persistance of old and now irrelevant information, perpetuated by the kind but flawed habit people have of pulling information together – but not testing it.
Treat everything on the net with caution if it has no proof. Even then be cautious
– I know I have “proved” a couple of things that turned out to be misunderstandings…
You can of course post to forums to ask for information and help, and people will often come to your aid. But you are often not really understanding the subject by doing that, you are just learning facts. It’s like learning the dates of the two World Wars and not understanding why the wars occured. I would point you to this posting by Lisa Dobson from a couple of years back, which makes the point about what you stand to learn, and also says something about how to ask for help. If it helps you to do the “right thing”, think of it selfishly. You will get better and more specific help if you have already looked into your issue and can ask specific questions. Also, if you properly learn something rather than just get a couple of facts about it, you are less likely to look foolish when you repeat those facts in a context they are not valid in. And you will.
Sorry, side tracked a little into one of my pet annoyances. Back to topic.
I want to know about SQL AUDIT. So I google SQL AUDIT ORACLE. Lots of hits. Let’s start filtering. First off, anything by “experts-exchange” and the other pay-for forums can forget it. Sorry guys but if I am going to spend money I’ll buy a manual. I will also ignore any stuff by sites that constantly suggest you go on training courses on boats with them or are “Team America” {everyone seen the film by Trey Parker? Puts the claim “We are the American Team” into a different light…}.
Now I go and look at the sites and I try making my search more intelligent, maybe adding in the word DBA_AUDIT_TRAIL and the like. I try and think what words and phrases someone explaining the topic would use which would not be common for other topics. That is why I often use database object names and commands in my searches.
In the case of SQL AUDIT, there are plenty of sites that generally pull together the basics from the manuals and tell you how to audit a few things and see the results and give some nice examples. It gets you further forward, but it’s mostly not very detailed. Just cookery instructions on what to do but not how it works. Thankfully, there is an excellent article by one of the experts in the field, Pete Finnigan.
Maybe I could have replaced this post by simply suggesting you just go to Pete’s web site, read what is there and follow the link from it to the ones he likes. It would work for the topic of SQL AUDIT. However, although it is always good to go to the sites of people you know and trust, it is always worth doing a google and going beyond the first page or two of results. Those first pages are mostly for a handful of very popular sites and sources. A new article or someone who is relatively unknown but has the answers you need may be further down the list, like pages 3 or 4. It is worth 5 mins just checking.
However, you are not likely to find everything you need. Certainly with SQL AUDIT you won’t find much about performance impact other than bland and not-very-helpful generic warnings that “Use of SQL AUDIT can carry a significant performance overhead”. How much overhead? for what sort of audit? And how do you know? In fact, when searching I found this, admittedly old, comment by Pete about there being relatively little “out there” about performance impact of Auditing. That made me smile, as that information was exactly what I was after.
*sigh*. The information I want does not seem to be out there. I need to do some testing.
That is for the next post (“at LAST”, I hear you all cry).
Testing Methodolgy – The Groundwork January 20, 2010
Posted by mwidlake in Perceptions, Testing, Uncategorized.Tags: data dictionary, knowledge, Testing
add a comment
I want to start learning about using SQL AUDIT, as I mentioned a couple of days ago.
First question. What do I want to know about SQL AUDIT? I might just have thought “well, I do not know much about this area and I think I should – so I want to know everything”. That is OK, but personally I find it helps to make up a specific aim. Otherwise you can just flounder about {well, I do}. In this case I have decided I want to know:
- The options for auditing who is selecting key tables.
- How to audit when those key tables get changed.
- The impact on performance of that audit, and if it could be an issue.
- (4) follows on from (3), in that I want to find out how to control that performance impact.
For any of you who have been or are code developers, you hopefully appreciate test-driven coding. That is, you decide up front what the new code must achieve and design tests to ensure the code does it. You do not write any code until you have at least thought of the tests and written them down in a document. {Ideally you have written the tests and built some test data before you start, but then in an ideal world you would get paid more, have more holidays and the newspapers would tell the truth rather than sensational rubbish, but there you go
}
I do not think that learning stuff/testing as much different from developing code, thus the list above. I now know what I want to understand.
What next? I’m going to go and check the Oracle Documentation for the feature. And I am very careful to check the documentation for the version I will use. This is 10.2 for me. I know, the Oracle documentation can be pretty dry, it can be rather unhelpful and it is not very good at examples. But you can expect it to be 90% accurate in what it tells you. You can also expect it to be not-very-forthcoming about the issues, gotchas and bits that don’t work. {I have this pet theory that the official documentation only mentions how things do not work once a feature has been out for a version and people have complained that the documentation should let on about the limitations}.
So, for SQL AUDIT I suggest you go and read:
- Concepts Manual, chapter 20 Database Security. If I am not rushed I would read the whole chapter, I might realise that what I want to do is better done with some other tool (If I wanted to see who had changed records months down the line, I think I would pick up that database triggers were a better bet, for example).
- SQL Reference, chapter 13 , the section on AUDIT (no surprises there). I do not do much more than read through the SQL manual once though, as frankly I find it pretty useless for explaining stuff, but it puts into your head what the parts of the command there are and pointers to other parts of the documentation. I’ll read the concepts manual with more attention. In this case, the manual will lead me to:
- Database Security Guide chapter 8. Which is pretty good, actually.
- My next source of information, may not immediately spring to mind but I find it very valuable, is to find out which data dictionary objects are involved in the feature. In this case, the previous sources would lead me to go to the Database Reference and check out:
- DBA_AUDIT_TRAIL, DBA_OBJ_AUDIT_OPTS, DBA_PRIV_AUDIT_OPTS, DBA_STMT_AUDIT_OPTS. And of course, SYS.AUD$. {I actually queried DBA_OBJECTS for anything with the word ”AUDIT” in it, check out all the tables and also had a quick peak at the text for any views, which would have led me to SYS.AUD$ if I did not already know about it}.
Why do I go and look at the data dictionary objects and the reference guide? After all, is it not nerdy enough to have put myself through reading the SQL Reference manual? {and let us be honest, it is rarely enjoyable reading the SQL Reference manual}. Because I want to know how it works, not just how to use it. Seeing the table give me a lot of information and the description of the columns may well tell me a lot more. First thing, SYS.AUD$ only has one index, on a column SESSIONID# (I know, there is another column in the index, I need to get to a DB to check this). Any queries not via this index are going to scan the whole damned thing. Right off, I suspect this will be an issue.
I will DESC the tables, see if there is already any information in them. In this case, there was not. A clean sheet.
Why did I not just go to Google (Bing, Yahoo, whatever) and search? Because I can trust the manuals to tell me stuff which is mostly true and is valid for my release. Not stuff about older versions, about later versions, urban myths or just outright fallacies. The manuals certainly will not tell me everything, far from it, but what it does say is solid stuff. With this reliable start I can now go to other sources and have some chance of filtering all the other stuff that is Out There. Once filtered, it is probably a lot more informative and easier to digest than the manuals.
I’ll ramble on about that next posting.

