jump to navigation

Format of Date Histograms February 6, 2010

Posted by mwidlake in internals.
Tags: , ,
4 comments

Oracle annoyingly handles dates internally in several formats. Dates are stored in tables as seven bytes, each byte representing century, year-in-century, month, day, hour, minute and second, shifted by different amounts. For the high/low values seen in DBA_TAB_COLUMNS or DBA_TAB_COL_STATISTICS, it is stored as a RAW value, where a two-digit hex string represents the century, year-in-century,month etc as before – see this post on decoding high and low column values and check out the comments for corrections.

So what about histograms? You might want to know what is in the histogram for a date column in order to better understand the decisions made by the CBO. Below, I pull out the histogram for an example date column {I’ve trimmed the output a little to save space}:

select table_name
,column_name
,endpoint_value end_val
,endpoint_number rowcount
from all_tab_histograms
where table_name ='TEST_TABLE_X'
and owner ='TEST_1'
and column_name = 'PLACED_DT'
order by endpoint_number

TABLE_NAME      COLUMN_NAME   END_VAL       ROWCOUNT
--------------- ------------- ------------- ---------------
TEST_TABLE_X     PLACED_DT   2,452,258         0
TEST_TABLE_X     PLACED_DT   2,454,334         1
TEST_TABLE_X     PLACED_DT   2,454,647         2
TEST_TABLE_X     PLACED_DT   2,454,737         3
TEST_TABLE_X     PLACED_DT   2,454,820         4
TEST_TABLE_X     PLACED_DT   2,454,867         5
TEST_TABLE_X     PLACED_DT   2,454,929         6
TEST_TABLE_X     PLACED_DT   2,454,981         7
TEST_TABLE_X     PLACED_DT   2,455,006         8
TEST_TABLE_X     PLACED_DT   2,455,024         9
TEST_TABLE_X     PLACED_DT   2,455,039         10
TEST_TABLE_X     PLACED_DT   2,455,050         11
...
TEST_TABLE_X     PLACED_DT   2,455,205         42
TEST_TABLE_X     PLACED_DT   2,455,207         43
TEST_TABLE_X     PLACED_DT   2,455,209         44
TEST_TABLE_X     PLACED_DT   2,455,211         45
TEST_TABLE_X     PLACED_DT   2,455,213         46
TEST_TABLE_X     PLACED_DT   2,455,215         47
TEST_TABLE_X     PLACED_DT   2,455,216         48
TEST_TABLE_X     PLACED_DT   2,455,218         49
TEST_TABLE_X     PLACED_DT   2,455,220         50
TEST_TABLE_X     PLACED_DT   2,455,221         51
TEST_TABLE_X     PLACED_DT   2,455,222         52
TEST_TABLE_X     PLACED_DT   2,455,222         53
TEST_TABLE_X     PLACED_DT   2,455,222         54
TEST_TABLE_X     PLACED_DT   2,455,222         55
TEST_TABLE_X     PLACED_DT   2,455,223         56
TEST_TABLE_X     PLACED_DT   2,455,223         57
TEST_TABLE_X     PLACED_DT   2,455,223         58
TEST_TABLE_X     PLACED_DT   2,455,223         59
...
TEST_TABLE_X     PLACED_DT   2,455,223         69
TEST_TABLE_X     PLACED_DT   2,455,223         70
TEST_TABLE_X     PLACED_DT   2,455,223         71
TEST_TABLE_X     PLACED_DT   2,455,223         72
TEST_TABLE_X     PLACED_DT   2,455,223         73
TEST_TABLE_X     PLACED_DT   2,455,224         74
TEST_TABLE_X     PLACED_DT   2,455,226         75

Well, it looks like a seven digit number so it must be representing the date in a similar way to as described above, yes? No. The format is obviously something different {Oh come ON Oracle, some internal standards would be nice once in a while! :-) }

I pulled out the minimum and maximum values from the DBA_TAB_COLUMNS table and translated them:-

COLUMN_NAME  NUM_DIST   LOW_V               HI_V
------------ ---------- ------------------- -------------------
PLACED_DT    375,428    2001-12-13 17:31:38 2010-01-28 23:51:38 

So the above low values and high values will pretty much match the first and last values in the histograms, which are 2452258 and 2455226. Any guesses? Those values from the histogram are very close to each other, only 2968 different to cover around 9 years of values. 9 times 365…

The histogram is representing the dates in Julian format, ie number of days since 1st Jan 4712BC. As a quick proof of this:

select to_date('2452258','J'),to_date('2455226','J')
from dual;

TO_DATE('2452258' TO_DATE('2455226'
----------------- -----------------
14-DEC-2001 00:00 29-JAN-2010 00:00

Well, what do you know. Very close to the 13th Dec 2001 and 28th Jan 2010

This of course makes sense, storing the date as an ascending numeric means it is simple to calculate the width of the range and how many values per day there are.

Imagine how complex it would be to do this if the date was stored in the bizarre way we humans deal with it – an ascending numeric for year, a cycling 12 digit number for month and a varying cyclic number for the day of the month. And that is ignoring other calendars in common use.

However, I’m looking at this method of representing the date and something bothers me. There is no allowance for the time portion. Maybe column histograms can’t cope with time? I feel a couple of tests coming on…

ADDITIONAL.
If you have seen the comments, you will know that Jonathan commented to ask if I might have truncated/been selective with the data in creating my test table as he is sure there is a fractional section representing the time portion.

Well, I did say I needed to check further so maybe I would have spotted my error on my own… :-)
This is the script I use to pull out histogram data (and yes, I trimed the output from the script before copying it into this post, so it does not quite match the script):

-- chk_hist.sql
-- Martin Widlake 7/4/4
-- pull out the histograms on a table
set pause on pages 32
spool chk_hist.lst
col owner form A8
col table_name form A15
col column_name form a20
col rowcount form 99,999,999,999
col end_val form 99,999,999,999
select owner
,table_name
,column_name
,endpoint_value  end_val
,endpoint_number rowcount
from all_tab_histograms
where table_name like upper(nvl('&tab_name','WHOOPS')||'%')
and  owner like upper('&tab_own')||'%'
and  column_name like upper('&col_name')||'%'
order by table_name,column_name,endpoint_number
/
spool off
clear colu

Hmm wonder what happens if I change the “col end_val form 99,999,999,999″ so that it would show fractions…

col end_val form 999,999,999.99999999

TABLE_NAME      COLUMN_NAM               END_VAL     ROWCOUNT
--------------- ---------- --------------------- ------------
TEST_TABLE_X    PLACED_DT     2,452,257.73030093            0
TEST_TABLE_X    PLACED_DT     2,454,333.76546296            1
TEST_TABLE_X    PLACED_DT     2,454,647.32561343            2
TEST_TABLE_X    PLACED_DT     2,454,737.25017361            3
TEST_TABLE_X    PLACED_DT     2,454,820.02204861            4
TEST_TABLE_X    PLACED_DT     2,454,866.98009259            5
TEST_TABLE_X    PLACED_DT     2,454,928.66848380            6
TEST_TABLE_X    PLACED_DT     2,454,980.94815972            7
TEST_TABLE_X    PLACED_DT     2,455,005.68413194            8
TEST_TABLE_X    PLACED_DT     2,455,023.67142361            9
TEST_TABLE_X    PLACED_DT     2,455,039.03236111           10
TEST_TABLE_X    PLACED_DT     2,455,050.39246528           11

Ahhhhh……

Thanks Jonathan :-)
It is still a Julian date, but with the time as a fraction as he said.

Friday Philosophy – Software being Good is not Good Enough February 5, 2010

Posted by mwidlake in Friday Philosophy, Uncategorized.
Tags: ,
4 comments

In a previous Friday Philosophy on In Case of Emergency I mention that something being simply a “Good Idea” with technology is not good enough. Even being a GREAT idea is not enough. It also has to be:

  1. Easy and simple to use. After all, using that funny stick thing behind your steering wheel in a car, to indicate which direction you are turning, seems to be too much of an effort for many people. If installing some bit of softare or running a web page is more than a little bit of effort, most people will not bother.
  2. Quick. No one has patience anymore, or spare time. This will probably be the fourth year in a row I do not plant any vegetables in our garden as I need to spend a day or two clearing and digging over the spot for said veg. You can’t beat home-grown veg. Similarly, I won’t use a web pages that takes as long to load as it does to plant a carrot seed.
  3. Known about. There could be a really fantastic little program Out There that allows you to take a screen shot, add a title and comment and pastes it straight into a document for you, converting to half a dozen common formats on the fly. But I do not know about it. { ScreenHunter is pretty good, I have to say, and when I have shown it to people a lot of them like it}.
  4. Popular. This is not actually the same as “known about”. For a stand-alone application to be good for you, you just need to know where it exists. Like maybe a free building architecture package. Whether thousands of people use it is moot, so long as you can get your extension drawings done in it with ease, that makes it great. But something that relies on the community, like a service to rate local eataries, unless lots of people use it and add ratings, well who cares. There are dozens (if not hundreds) of such community ”good ideas” started every day but unless enough people start to use it, it will fizzle out, as the vast majority of them do.

Point 4 is highly relevant to “In Case Of Emergency” as it is simple, quick and relativley known about. It just needs to be ubiquitous.

I became very aware of point 3 a few years ago and also of the ability for very clever people to be sometimes very stupid when it comes to dealing with their fellow humans.

I was working on a database holding vast quantities of DNA information. If you don’t know, DNA information is basically represented by huge long strings of A, C, T and G. So something like AACTCGTAGGTACGGGTAGGGGTAGAGTTTGAGATTGACTGAGAGGGGGAAAAATGTGTAGTGA…etc, etc, etc. These strings are hundreds, thousand, hundreds of thousands of letters long. And Scientists like to search against these strings. Of which there are millions and millions. Not for exact match mind, but kind-of-similar, fuzzy matches, where for example 95% of the ACTGs match but some do not. It’s called a BLAST match.

Anway, suffice to say, it takes a lot of compute power to do this and a fair amount of time to run. There was a service in America which would allow you to submit a BLAST query and get the answer in 20 minutes or so {I have no idea how fast it is now}. 

Some extremely clever chaps I had the pleasure of working with came up with a faster solution. Same search, under 5 seconds. Now that is GREAT. We put together the relevant hadware and software and started the service.  Now I thought it went beyond Good or even Great. It was Amazing (and I mean it, I was amazed we could do a fuzzy search against a billion such strings in 2, 3 seconds using a dozen or so PC-type servers).

No one used it. This was because almost no one knew about it and there was already this slow service people were used to using. People who used the old service never really thought to look for a new one and the chances were they would not have found ours anyway.

I pushed for more to be made of this new, faster service, that it should be advertised to the community, that it should be “sold” to people (it was free to use, by “sold” I mean an attempt made to persuade the scientific community it was worth their while investigating). The response I was given?

“If the service is worth using, people will come and use it”.

No they won’t. And indeed they didn’t. It was, I felt, a stupid position to take by an incredibly inteligent person. How were people to know it existed? Were they just supposed to just wake up one morning knowing a better solution was out there? The internet pixies would come along in the night and whisper about it in your ear? In the unlikely event of someone who would be interested in it just coming across it, were they then going to swap to using it? After all no one else seemed to know about it and it was 2 orders of magnitude faster, suspiciously fast, how could it be any good?

The service got shut down as it was just humming in the corner consuming electricity. No one knew it existed, no one found it, no one came. I can’t but help wonder how much it could have helped the scientific community.

There must be thousands of other “failed” systems across the IT world that never took off just because the people who could use it never knew it existed. Depressing huh?

Turning on SQL Audit February 2, 2010

Posted by mwidlake in Testing, development, performance.
Tags: , , ,
4 comments

<Previous post…

I want to test out using the SQL AUDIT functionality.

The first thing you have to do (having read up on it a bit) is to enable it for the database. You do this by setting the initialization parameter AUDIT_TRAIL. On version 10.2 you have the options to write the audit entires to:

  •  The DB, by setting it to DB or DB_EXTENDED {not DB,EXTENDED as the manual says, that is the old format}. This puts the entries into the table  SYS.AUD$
  • The operating system, by setting it to OS, XML or XML_EXTENDED. If you set it to XML or XML_EXTENDED then the data is written out in XML format. You also optionally set AUDIT_FILE_DEST to where you want to data to be written to.

Writing the audit trail to the OS is potentially more secure, as you can stop those cunning and devious DBAs messing with the audit trail. {I’m not so sure that this really helps that much – if anyone knows of any DBAs caught out being naughty solely as a result of using the OS to store the SQL AUDIT records, it would be a fascinating comment}

I want to write to the DB as I want to be able to get at the audit data easily and I am not sure how I want to interrogate it. I’m faster with SQL than SED and AWK.

I also decided up front I wanted to use DB_EXTENDED so that the triggering SQL statement and all bind variables are caught, so I can see more about what it triggering the audit record. I am cautious of the impact of storing CLOBs though, which these two values are stored as. I’ve had performance issues moving lots of CLOBS around and I know from some old colleagues that Secure Files are a lot faster. If Secure Files are faster, that means CLOBs are slower :-) . If the audit trail seems to add too much burden on my system, swapping back to just DB will be my first step.

Now for the bad news. You can’t just turn on AUDIT. That initialization parameter is not dynamic. You can’t even enable it for your session. It will need a restart of your database.

This tells me something. Oracle needs to do some setting up for SQL AUDIT when it starts the instance. Either start a new process, enable functionality in one of it’s regular processes or set up structures in memory to cope. Or a mixture thereof. I strongly suspect the need for memory structures {but this is only because, in reality, I have done some testing and I am writing this up afterwards}.

I should not really need to say this but DON’T go turning this on for a production system without extensive testing somewhere else first. There is not a lot “Out There” about the details of the performance impact of AUDIT but the general opinion is there is some; and that is reasonable given it is going to write database records for every action audited. Also, you have no idea yet of any knock-on effects. You know, things you did not expect that causes your database to lock or crash and you to get fired.

{Question, what happens if you alter the initialization file and restart only one node of a RAC database? I don’t know and so I should test that. My current test system is not RAC, but the final destination for this stuff is RAC}.

You probably also want to check that no one has gone and tried turning on SQL AUDIT on things already. You never know if someone else decided to have a play with this and issued a load of AUDIT statements only to find nothing happened – and left what they did in place “as nothing happened”. I already know of one example of this happening…

Here is a little script I knocked up to see what is currently set to be audited:

-- what_is_audited.sql
-- Martin Widlake 11/01/10
-- simple listing of what auditing is currently set
set pages 100
set pause on
spool what_is_audited.lst
select * from dba_priv_audit_opts
order by user_name,privilege
/
select * from sys.dba_stmt_audit_opts
order by user_name,audit_option
/
select * from DBA_OBJ_AUDIT_OPTS
order by owner,object_name
/
spool off
clear col
--
-- EOF
--

And some sample output. I’m not going to explain it in this post, but you can have a look though it.

DEV3&gt; @what_is_audited
USER_NAME                      PROXY_NAME
------------------------------ ------------------------------
PRIVILEGE                                SUCCESS    FAILURE
---------------------------------------- ---------- ----------
MDW1
ALTER SYSTEM                             BY ACCESS  BY ACCESS
MDW1
AUDIT SYSTEM                             BY ACCESS  BY ACCESS
MDW1
CREATE SESSION                           BY ACCESS  BY ACCESS

ALTER SYSTEM                             BY ACCESS  BY ACCESS

AUDIT SYSTEM                             BY ACCESS  BY ACCESS

CREATE SESSION                           BY ACCESS  BY ACCESS

6 rows selected.

USER_NAME                      PROXY_NAME
------------------------------ ------------------------------
AUDIT_OPTION                             SUCCESS    FAILURE
---------------------------------------- ---------- ----------
MDW1
ALTER SYSTEM                             BY ACCESS  BY ACCESS
MDW1
CLUSTER                                  BY ACCESS  BY ACCESS
MDW1
CONTEXT                                  BY ACCESS  BY ACCESS
MDW1
CREATE SESSION                           BY ACCESS  BY ACCESS
MDW1
DATABASE LINK                            BY ACCESS  BY ACCESS
MDW1
DELETE TABLE                             BY ACCESS  BY ACCESS
MDW1
...
TYPE                                     BY ACCESS  BY ACCESS
MDW1
UPDATE TABLE                             BY ACCESS  BY ACCESS
MDW1
USER                                     BY ACCESS  BY ACCESS
MDW1
VIEW                                     BY ACCESS  BY ACCESS

ALTER SYSTEM                             BY ACCESS  BY ACCESS

CLUSTER                                  BY ACCESS  BY ACCESS

CONTEXT                                  BY ACCESS  BY ACCESS

CREATE SESSION                           BY ACCESS  BY ACCESS

DATABASE LINK                            BY ACCESS  BY ACCESS

DIMENSION                                BY ACCESS  BY ACCESS

DIRECTORY                                BY ACCESS  BY ACCESS

INDEX                                    BY ACCESS  BY ACCESS

MATERIALIZED VIEW                        BY ACCESS  BY ACCESS
...
USER                                     BY ACCESS  BY ACCESS

VIEW                                     BY ACCESS  BY ACCESS

56 rows selected.

OWNER                          OBJECT_NAME                    OBJECT_TYPE
------------------------------ ------------------------------ --------------
ALT     AUD     COM     DEL     GRA     IND     INS     LOC     REN     SEL
------- ------- ------- ------- ------- ------- ------- ------- ------- ----
UPD     REF EXE     CRE     REA     WRI     FBK
------- --- ------- ------- ------- ------- -------
MWPERF                         FORN_M_SEQ                     SEQUENCE
-/-     -/-     -/-     -/-     -/-     -/-     -/-     -/-     -/-     A/A
-/-     -/- -/-     -/-     -/-     -/-     -/-
MWPERF                         PERSON                         TABLE
A/A     A/A     A/A     A/A     A/A     A/A     A/A     A/A     A/A     A/A
A/A     -/- -/-     -/-     -/-     -/-     A/A
MWPERF                         ROAD_TYPE                      TABLE
-/-     -/-     -/-     A/A     -/-     -/-     A/A     -/-     -/-     A/A
A/A     -/- -/-     -/-     -/-     -/-     -/-

If you discover you have a lot of things set to be audited, ESPECIALLY if they are auditing select access, think about turning some or all of it off before you enable AUDITING by setting that initialization parameter.

Once you have turned on the feature, you can start testing it…

Friday Philosophy – ICE {In Case of Emergency} January 31, 2010

Posted by mwidlake in Friday Philosophy.
Tags: , ,
6 comments

ICE is a simple concept. In this case it stand for In Case of Emergency and the idea is to store a contact number on your mobile phone under the identifier of ICE. Then if you are in an accident, suddenly become very ill or are in any other way incapacitated, your ICE number can be called. The person you list under ICE is someone who knows you well and hopefully knows of any medical conditions you have and who can get in touch with others. It can be incredibly useful to medical services to know if you are alergic to common drugs or have any known medical conditions (like heart issues or diabetes). I guess in worst scenario of you being, well, not alive anymore, it gives someone to contact who would want/need to know. What a nice, simple use of modern technology! Go one, get your phone out and put and ICE number in now.

The idea originally came from Bob Brotchie, a UK paramedic.
The idea has caught on enough that there are companies in America trying to make a bit of profit out of it {something that I feel slightly negative about} and it has a wikipedia entry.

There is one big issue, which is if you have locked your mobile phone, no one is going to be able to see your contacts and thus the ICE details. This is something that others have thought of and one suggestion is to make your wallpaper show your ICE contacts.

However, this idea of ICE only works if people know about it and use it. I became aware of this last year when I saw an old lady collapse in the street. She just stopped, staggered a little and went down, attempting to take a brick out of a wall with her head as she went down. Three or four of us rushed over, thankfully one was a nurse so she took charge of looking after the patient. We others quickly found her phone. I bet what you are now expecting me to say is that she had no ICE number. She might have, but none of us knew to LOOK for an ICE number. We took pot-luck on the number saying “Jack at work” or something and thankfully got her husband.

Maybe we were an unusually unknowing bunch of people and all you lot reading this know about ICE numbers, but given we were all turned on enough to come to the lady’s aid, one was a nurse, I work in IT and none of us knew about this useful use of technology, I suspect it is not that universal an idea yet. I only know about ICE as my H&S brother told me about it only a couple of weeks after the above incident. {He was asking me if I could see a negative side to it and all I could think of is that if someone found/stole your phone then they had a known “someone who cares” number for you, but then they also have your whole contact list if you do not lock your phone, with things like “Mum” and “Uncle Bob” on it}

However, it takes only a couple of minutes to put an ICE number on your phone, so nothing is stopping you doing it. If you have a modern “all singing, all dancing” phone you might have an ICE feature or app you can download to show ICE information with the phone still locked (my phone is only 4 months old but has no such feature, but then it was a cheap, temporary “just for the week” buy when my old phone committed suicide). A quick check shows the iPhone app can also show things like drug susceptibility and known medical issues too, which is more immediate help to emergency services than a contact number.

So, I would encourage you to put an ICE number on your mobile phone. I would also encourage you to spread the word about ICE. It’s a great, easy, simple use of technology, but only if it is popular.

Just a pointer to an update January 27, 2010

Posted by mwidlake in Testing.
Tags:
2 comments

This post is really just to highlight that I finished salvaging Yesterdays Post. If you found it of any interest before, go have a look at the end. If not, heck go look at dilbert. As funny as ever but BOY is that web site suffering from advertising hell and slow performance…

Testing Methodology – How to Test #2 January 26, 2010

Posted by mwidlake in Testing, performance.
Tags: ,
1 comment so far

<previous post …

Last post I (see link above) I said something about how I like timing how long things {usually SQL queries but you can apply this to more complex situations} take as it is simple. But I highlighted that it is an approach that misses a lot of information and also can catch you out if you do not appreciate that the first run of any test script is likely to be slow (due to parsing and data caching overheads which are reduced for subsequent itterations).

I want to continue on that theme now, of simple testing with just how long things take. And how to cope with variation.

Hands up all of you who have Oracle on a PC at home? Great, you can test what you want on a dedicated machine. No one else is running anything on your machine, no one else is using your storage, no one else is using your network (if you have a network at home) and no one is running the SQL statement from hell on your database.

BUT. You might have some download of the latest security patch set running in the background, your virus scanner may kick in (or you might just have Norton full-security-everything-running-on-your-cpu-all-the-time turned on). Your miles per gallon may vary, especially on Windows but also on Linux.

For many of us we are testing on a server at work, where developers are working, where the storage is shared, where the network is dealing with that lady behind you watching “Celebrity Strictly come roller-skate dancing impersonations” {well, she sat behind me for 4 months and she was in the Quality team, what does that tell you}. Bottom line, the performance of your server will vary, your testing needs to cope with that.

How do you cope with a varying workload on the system you are running tests on? Well, you run the new and old version of your test several times, in succession, interleaved. This is ideal when , in the very un-ideal situation of having to test on a Live situation. Testing on “Live” is wrong, in the same way that spelling “initialisation” with a Z is wrong, but it is often forced upon us.

As an example, I want to check into the questionable suggestion someone made that selecting count(*) from dba_tables where owner=user is faster than selecting count(*) from user_tables.

So, I knock up a quick sql*plus script that runs the two alternatives in quick succession, interleaved.

--testa.sql
set timi on pause off
spool testa.lst
--
prompt run 1
select count(*) from user_tables;
select count(*) from dba_tables where owner=user;
--
prompt run 2
select count(*) from user_tables;
select count(*) from dba_tables where owner=user;
--
prompt run 3
select count(*) from user_tables;
select count(*) from dba_tables where owner=user;
--
prompt run 4
select count(*) from user_tables;
select count(*) from dba_tables where owner=user;
--
prompt run 5
select count(*) from user_tables;
select count(*) from dba_tables where owner=user;
--
spool off
-- eof

Just a couple of things to mention. I always spool out to a file called the same thing as the script, with .lst at the end (which is the default file extension for spool commands but I like to state it) and I like to use “prompt” to record in the output what is going on. Here it is obvious, sometimes it is not. Oh, and I like to put –EOF at the end of my files, so I can spot cut-and-paste errors. I know, I am very “command line” centric. I love pictures too Doug. Finally, I should not run the two versions with the same one first each time, I should swap them over after every two runs (not each run as then you are running A,A,B,B,A,A,B,B. A more complex A,B,A,B,B,A,B,A is better). But the results look messy, so I didn’t.

Here is the output (trimmed a little, for the sake of brevity):-

run 1

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.58

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.73

run 2

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.28

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.10

run 3

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.28

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.10

run 4

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.28

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.10

run 5

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.29

  COUNT(*)
----------
        35
1 row selected.
Elapsed: 00:00:00.09

At this point I might pull the results into Excel, as it is so good at drawing pretty graphs, but I think we can interpret the results “by eye” in this case.

Run    User Tabs   DBA_Tabs
1        0.58          0.73
2        0.28          0.10
3        0.28          0.10
4        0.28          0.10
5        0.29          0.09

AVG      0.28          0.10

My Average is ignoring the first run for each version of the code, as previously explained {parse overhead/warming caches}

You can see that version B is considerably faster than A. In this case, there is no overlap between the two result sets, by which I mean every run o version B is faster than every run of version A. Also, there is little variation in the performance of each version.

What if you got a result set like:-

Run    User Tabs   DBA_Tabs
1        0.77          0.68
2        0.35          0.25
3        0.42          0.34
4        0.48          0.38
5        0.48          0.30
6        0.41          0.29
7        0.40          0.28

AVG      0.42          0.31

If you look at the figures, both A and B slow down and then start to speed up. Something happened to slow down the system in the middle of the test and it was recovering but not back to “normal” by the end. If we had done 7 runs of A followed by 7 runs of B, B would have been hard hit by the temporary system slow-down {I opened a WORD document :-) }.

Also, there is some overlap in the results for A and B. The slowest result for B, 0.38, is slower than for the fastest result for A, 0.35. When the spread of times for test A and test B overlap like this, you need to do a few more tests to ensure the results are consistent. I did 7 but I should really have done 9 or maybe 15.
In any case, B is consistently 25% faster than A. It is Faster.

How about this result set:

Run    User Tabs   DBA_Tabs
1        0.87          0.71
2        0.41          0.42
3        0.47          0.43
4        0.37          0.42
5        0.39          0.34
6        0.51          0.38
7        0.42          0.40

AVG      0.43          0.40

The variation in the result sets is higher and if fact if you only looked at results for paired runs 2,3 and 4 you would come to the conclusion A was very slightly faster than B. In fact, B is slightly faster than A.

Or is it? There are only 6 tests {remember, ignore run 1}, the variation within the sets is high (.37 to .51 in A, .34 ot .42 in B) and the overall difference is low. You could run a statistical analysis on this, a “Student T” test I think, to see if the difference was significant. But unless I was looking at something utterly business critical at this point where the smallest fraction of improvement was important, I would not bother. I would be far better off looking for solution C or doing something else completely. If you ever find yourself doing scientific statistical analysis to decide which of two options is faster, it is probably time to go home and consider what else you could be doing to help your employer more…

Enough for tonight and HOPEFULLY the wordpress pixies will not eat the end of this post (yesterday’s effort was better than tonights I think…)

Testing Methodology – How To Test January 26, 2010

Posted by mwidlake in Testing, performance.
Tags: , ,
1 comment so far

<Previous Post…

On those rare but pleasant occasions when I find myself running a training course on performance, something I always want to press home is “How to Test”.

I believe you can learn everthing in every manual on oracle technology and internals and still be very poor at performance tuning. Similarly, I think you can be lacking an awful lot of knowledge and still be good at performance tuning. It comes down to how you test. Not just how to test, but how you as an individual design and run your tests.

I joke with whoever I am talking to that what you need most of all to test is a watch and someone calling out “start” and “Stop”. ie you need to be able to time things. It is a bit of a throw-away statement, but actually most of us will do exactly this on a regular basis. We will be working on something, run it and it will come back in a few seconds. Then we will tweak it and run it again and mentally {or in my case, just very quietly under my breath} count. We even discuss it with people like that “How long did it take that time?” Ohh, a couple of seconds faster than last time”.

I like tuning by timing very, very, very much.

Firstly, it is simple – If a SQL query runs faster, it runs faster. If you tune by looking at the explain plan and you see a full table scan being replace with a nested loop and an index look up, is it faster? It depends. If you tune by looking at the buffer gets and other statistics from the SGA (or wherever), if the “buffer gets” go down, is it faster? This depends again. If the disk reads went up, even by a realtively small amount, maybe not. If the memory usage went through the roof because of a sort that spills down to disc, well quite probably not. Obviously if all of buffer gets, disk reads and cpu usage went down, you can be pretty certain you are having a positive impact in speeding up the statement. But timing the statement from start to finish gives you a nice, simple answer on if it runs faster.

Secondly, it is simple. You do not have to look at plans, at runtime statistics, at deltas of session statistics, at trace files. All those things are good but you need more knowledge and experience to use them and time to set up, collect and study them. This is not to say you do not get a lot more out of tuning if you understand all of the stuff about trace files, explain plans etc, I hasten to add – but you do not need that to get going with performance tuning.

Thirdly, it is simple. You tell your manager’s manager that you use 47% less buffer gets, 12% less disk reads but 9% more CPU then they will ask you what all that means. You tell them that version A runs in 2 minutes and 9 seconds and version B in 34 seconds, they will understand. Better still, graph it and give them a power point…

Fourthly, it is simple. You can see that statement (a) is faster or slower than statement (b). Now you can look at the plan, at the statistics for the statement, at what wait events are occuring and start tying up book knowledge with real-world results.

Of course, timing with a watch is very crude. You have a very capable piece of computing power underlying that database of yours, so let’s get it to do the timing.

As a simple start, in SQL*Plus use “set timing on” (it can be abbreviated to “set timi on”). Most GUI SQL tools will either default to telling you the elapsed time or have an obvious option to switch on the functionality.

{Oh, I’ll just mention that if you cannot get timing in sql*plus or wherever to work you, might want to check what the initialisation parameter “TIMED_STATISTICS” is set to. Some ancient memory is telling me that if it is set to FALSE, you may not be able to use TIMING in SQL*Plus but another memory is telling me that stopped being true a while back, version 8 maybe. I tried setting TIMED_STATISTICS to false in my session on 10.2 but TIMING still worked, but then I left STATISTICS_LEVEL alone and that cause TIMED_STATISTICS to be set. It is so long ago that I worked on a system that had TIMED_STATISTICS set to false! Even a quick google did not throw up an immediate answer}.

DB10.2> select count(*) from sn
  2  /
any key> 

  COUNT(*)
----------
       116

1 row selected.

DB10.2> set timi on
DB10.2> select count(*) from sn
  2  /
any key> 

  COUNT(*)
----------
       116

1 row selected.

Elapsed: 00:00:01.09

There you go, the count of SN records, all 116, took 1.09 seconds.

Yes, I had “set pause on” and the timing includes how long it takes me to spot that the query has finished and press a key. We all do it. However, sometimes the need for user input it still missed {Something I see quite often is, for example, not pressing the button in PL/SQL developer to get ALL the rows for the SQL statement, rather than just the first screenful}. A key thing is to try and remove from testing all and any waiting for user response, as we humans are slow and irratic.

so SET PAUSE OFF.

Now you have TIMING on and pause off. Time to run something and see how long it takes, then try and speed it up and run again:

DB10.2> select count(*) from person where to_char(dob,'YYYY') = 1988
  2  /

  COUNT(*)
----------
        29
Elapsed: 00:00:01.15

DB10.2> create index per_dob on person(dob);

Index created.

Elapsed: 00:00:01.31
DB10.2> select count(*) from person where to_char(dob,'YYYY') = 1988;

  COUNT(*)
----------
        29
Elapsed: 00:00:00.14

There you go, I added an index and the query went down from 1.15 seconds to 0.14, that is 8 times faster. Timing is timing.
Well, no, and this is something you need to be careful of if you are new to tuning.

The second itteration is nearly always faster.

Why? Well, the first time you run a piece of SQL it has to be parsed for a start, and that takes some time. More importantly, the first time you select the data, it is going to be on disk. Oracle has read it in and put it into memory. The second time you query the same data, it will be found in memory. That {nearly always} makes the next access to the data a lot faster. The index was not being used as I had a function on the column in the WHERE clause and this stops the index from being used.

So having said I love testing by timing, you need to be cautious about one-off tests. Oh, and here below is proof that the index I created is making no real difference to the speed of the SQL query:

DB10.2> set autotrace on
DB10.2> select count(*) from person where to_char(dob,'YYYY') = 1988;

  COUNT(*)
----------
        29
Elapsed: 00:00:00.12

Execution Plan
-----------------------------------------------------------
| Id  | Operation          | Name   | Rows  | Bytes | Cost
-----------------------------------------------------------
|   0 | SELECT STATEMENT   |        |     1 |     9 |   335
|   1 |  SORT AGGREGATE    |        |     1 |     9 |
|*  2 |   TABLE ACCESS FULL| PERSON |    36 |   324 |   335
-----------------------------------------------------------

Statistics
----------------------------------------------------------
         20  recursive calls
         19  db block gets
        727  consistent gets
          0  physical reads
       1992  redo size

DB10.2> drop index per_dob
  2  /

Index dropped.

Elapsed: 00:00:00.03
DB10.2> select count(*) from person where to_char(dob,'YYYY') = 1988
  2  /

  COUNT(*)
----------
        29
Elapsed: 00:00:00.15

Execution Plan
----------------------------------------------------------
| Id  | Operation          | Name   | Rows  | Bytes | Cost
----------------------------------------------------------
|   0 | SELECT STATEMENT   |        |     1 |     9 |  335
|   1 |  SORT AGGREGATE    |        |     1 |     9 |
|*  2 |   TABLE ACCESS FULL| PERSON |    36 |   324 |  335
----------------------------------------------------------

Statistics
----------------------------------------------------------
        261  recursive calls
         19  db block gets
        841  consistent gets
          0  physical reads
       1992  redo size

We see 0.12 seconds goes to 0.14 seconds, exactly the same explain plan for both statements, a small increase in consistent gets, no physical gets by either statement (so the data is cached).
Why is the second statement a little slower and has a large increase in recursive calls and db block gets? Because I dropped the index and the statement had to be reparsed. Now, if you are new to tuning you would almost certainly not have appreciated what the recursive calls and DB block gets were all about, it could distract you from the question of “does it run faster”. It is certainly good to know all about that, but when you are starting off, you want to keep things simple and learn in stages.

What the above demonstrates, I hope, is that the second thing you run will have an advantage and could probably run faster even though, in reality, it is using more resource. And we tend to run old code first and new code second. So swap them over, give the old code the advantage of being run second.

Do not test things once, as you can easily be caught out. Test each version several times. And ignore the first run of each version. This is not perfect advice, code in production may well be being parsed and gathering data from disk, but unless you can allow for this in your testing, I think it is generally better, for simple testing, to run each version 6 times. Of the six runs, ignore the first run of each and average the results of the other 5. Which ever one runs faster on average is, well, fastest. IF the difference is significant.

Oh. Where is the SQL AUDIT in all this? Well, ponder on why am I generating REDO for a simple select…

Testing Methodology – Getting Community Information January 22, 2010

Posted by mwidlake in Testing, Uncategorized.
Tags: ,
2 comments

<Last post I tried to highlight that knowing specifically what you want to understand before you start testing is important and that it is beneficial to start with the booring official documentation. This is so that you can filter what is Out There in the web, as well as get a good grounding in what is officially possible.

There is no doubt that you can get a lot more information on Oracle features from the community than you can from the manuals and that it is often presented in a more easily understood and relevant way. But some of it is not right for your version or is just plain wrong. I can do no better than to refer to this recent posting by Jonathan Lewis on the topic. In this case, it is the persistance of old and now irrelevant information, perpetuated by the kind but flawed habit people have of pulling information together – but not testing it.

Treat everything on the net with caution if it has no proof. Even then be cautious :-) – I know I have “proved” a couple of things that turned out to be misunderstandings…

You can of course post to forums to ask for information and help, and people will often come to your aid. But you are often not really understanding the subject by doing that, you are just learning facts. It’s like learning the dates of the two World Wars and not understanding why the wars occured. I would point you to this posting by Lisa Dobson from a couple of years back, which makes the point about what you stand to learn, and also says something about how to ask for help. If it helps you to do the “right thing”, think of it selfishly. You will get better and more specific help if you have already looked into your issue and can ask specific questions. Also, if you properly learn something rather than just get a couple of facts about it, you are less likely to look foolish when you repeat those facts in a context they are not valid in. And you will.

Sorry, side tracked a little into one of my pet annoyances. Back to topic.

I want to know about SQL AUDIT. So I google SQL AUDIT ORACLE. Lots of hits. Let’s start filtering. First off, anything by “experts-exchange” and the other pay-for forums can forget it. Sorry guys but if I am going to spend money I’ll buy a manual. I will also ignore any stuff by sites that constantly suggest you go on training courses on boats with them or are “Team America” {everyone seen the film by Trey Parker? Puts the claim “We are the American Team” into a different light…}.

Now I go and look at the sites and I try making my search more intelligent, maybe adding in the word DBA_AUDIT_TRAIL and the like. I try and think what words and phrases someone explaining the topic would use which would not be common for other topics. That is why I often use database object names and commands in my searches.

In the case of SQL AUDIT, there are plenty of sites that generally pull together the basics from the manuals and tell you how to audit a few things and see the results and give some nice examples. It gets you further forward, but it’s mostly not very detailed. Just cookery instructions on what to do but not how it works. Thankfully, there is an excellent article by one of the experts in the field, Pete Finnigan.
Maybe I could have replaced this post by simply suggesting you just go to Pete’s web site, read what is there and follow the link from it to the ones he likes. It would work for the topic of SQL AUDIT. However, although it is always good to go to the sites of people you know and trust, it is always worth doing a google and going beyond the first page or two of results. Those first pages are mostly for a handful of very popular sites and sources. A new article or someone who is relatively unknown but has the answers you need may be further down the list, like pages 3 or 4. It is worth 5 mins just checking.

However, you are not likely to find everything you need. Certainly with SQL AUDIT you won’t find much about performance impact other than bland and not-very-helpful generic warnings that “Use of SQL AUDIT can carry a significant performance overhead”. How much overhead? for what sort of audit? And how do you know? In fact, when searching I found this, admittedly old, comment by Pete about there being relatively little “out there” about performance impact of Auditing. That made me smile, as that information was exactly what I was after.

*sigh*. The information I want does not seem to be out there. I need to do some testing.

That is for the next post (“at LAST”, I hear you all cry).

Testing Methodolgy – The Groundwork January 20, 2010

Posted by mwidlake in Perceptions, Testing, Uncategorized.
Tags: , ,
add a comment

<Previous PostNext Post …>

I want to start learning about using SQL AUDIT, as I mentioned a couple of days ago.

First question. What do I want to know about SQL AUDIT? I might just have thought “well, I do not know much about this area and I think I should – so I want to know everything”. That is OK, but personally I find it helps to make up a specific aim. Otherwise you can just flounder about {well, I do}. In this case I have decided I want to know:

  1. The options for auditing who is selecting key tables.
  2. How to audit when those key tables get changed.
  3. The impact on performance of that audit, and if it could be an issue.
  4. (4) follows on from (3), in that I want to find out how to control that performance impact.

For any of you who have been or are code developers, you hopefully appreciate test-driven coding. That is, you decide up front what the new code must achieve and design tests to ensure the code does it. You do not write any code until you have at least thought of the tests and written them down in a document. {Ideally you have written the tests and built some test data before you start, but then in an ideal world you would get paid more, have more holidays and the newspapers would tell the truth rather than sensational rubbish, but there you go :-) }

I do not think that learning stuff/testing as much different from developing code, thus the list above. I now know what I want to understand.

What next? I’m going to go and check the Oracle Documentation for the feature. And I am very careful to check the documentation for the version I will use. This is 10.2 for me. I know, the Oracle documentation can be pretty dry, it can be rather unhelpful and it is not very good at examples. But you can expect it to be 90% accurate in what it tells you. You can also expect it to be not-very-forthcoming about the issues, gotchas and bits that don’t work. {I have this pet theory that the official documentation only mentions how things do not work once a feature has been out for a version and people have complained that the documentation should let on about the limitations}.

So, for SQL AUDIT I suggest you go and read:

  • Concepts Manual, chapter 20 Database Security. If I am not rushed I would read the whole chapter, I might realise that what I want to do is better done with some other tool (If I wanted to see who had changed records months down the line, I think I would pick up that database triggers were a better bet, for example).
  • SQL Reference, chapter 13 , the section on AUDIT (no surprises there). I do not do much more than read through the SQL manual once though, as frankly I find it pretty useless for explaining stuff, but it puts into your head what the parts of the command there are and pointers to other parts of the documentation. I’ll read the concepts manual with more attention. In this case, the manual will lead me to:
  • Database Security Guide chapter 8. Which is pretty good, actually.
  • My next source of information, may not immediately spring to mind but I find it very valuable, is to find out which data dictionary objects are involved in the feature. In this case, the previous sources would lead me to go to the Database Reference and check out:
  • DBA_AUDIT_TRAIL, DBA_OBJ_AUDIT_OPTS, DBA_PRIV_AUDIT_OPTS, DBA_STMT_AUDIT_OPTS. And of course, SYS.AUD$. {I actually queried DBA_OBJECTS for anything with the word ”AUDIT” in it, check out all the tables and also had a quick peak at the text for any views, which would have led me to SYS.AUD$ if I did not already know about it}.

Why do I go and look at the data dictionary objects and the reference guide? After all, is it not nerdy enough to have put myself through reading the SQL Reference manual? {and let us be honest, it is rarely enjoyable reading the SQL Reference manual}. Because  I want to know how it works, not just how to use it. Seeing the table give me a lot of information and the description of the columns may well tell me a lot more. First thing, SYS.AUD$ only has one index, on a column SESSIONID# (I know, there is another column in the index, I need to get to a DB to check this). Any queries not via this index are going to scan the whole damned thing. Right off, I suspect this will be an issue.

I will DESC the tables, see if there is already any information in them. In this case, there was not. A clean sheet.

Why did I not just go to Google (Bing, Yahoo, whatever) and search? Because I can trust the manuals to tell me stuff which is mostly true and is valid for my release. Not stuff about older versions, about later versions, urban myths or just outright fallacies. The manuals certainly will not tell me everything, far from it, but what it does say is solid stuff. With this reliable start I can now go to other sources and have some chance of filtering  all the other stuff that is Out There. Once filtered, it is probably a lot more informative and easier to digest than the manuals.  

I’ll ramble on about that next posting.

Testing Methodology January 19, 2010

Posted by mwidlake in Testing.
Tags:
3 comments

This is my 101st posting and {almost} my start for 2010. I was going to kick off 2010 on something I knew well, so I could look all smart – specifically, handling stats for big databases. But I have decided to kick off on something I know very poorly. Security. Namely, use of SQL AUDIT. Why? Why blog about something I know little about?

Because I want to blog about the process of finding out about stuff and testing that stuff. It’s actually going to be a thread about testing – the SQL AUDIT is just an excuse {and matches my work life, which is jolly important when time is limited and you need to keep the employer happy}. I started out my whole blog (before almost anyone paid any attention to my meanderings) on what you could find out just from doing a “select count(*)” from a table. You can find out a lot from simple beginings.

How do you test something? Well, that question is actually a step or two down the line from “how do I understand something”. Sorry, I was trained as a scientist at college and you get sold this line as a trainee scientist about Baconian Science whereby you record all the data about something and then come to conclusions. It does not work really. You need an idea first and then you need to test that idea.

So, in the case of IT, you come across something (the initial idea) and you want to know how it works. It is usually a feature of the software new to you. With software (and the Oracle Database is really just a huge pile of software) there is a source of starter information and it is called the “documentation”. If I was a Baconian scientist I would just use the feature and record everything I could think of about it and record what I discovered. But this is software and some human (or humans) designed it and implemented it. And documented it.

So, First thing, don’t google it. Go and read the official manual on it. It is not going to tell you everything (it is, after all, written by people desperate to put it in the best light possible – and yet leave space of consultancy and training dollars to be earned) and remember that the manual can be wrong, but it is likely to be more accurate than 80% of what you come across on web searches. {If I was a tabloid newspaper I would go and ask a bunch of people who knew little about the subject what they thought and then publish an article on it, emphasising any shocking or outrahgeous parts. Remember that when you Google or Bing or Yahoo anything, Anything. }.

Having read (and I would suggest you start with) the Concepts Manual on the feature and then any specific manual covering the feature, now do your web search and…
(a) look for sources you have grown to trust. Not popular sources necessarily, sources where you have rarely found them wrong or they publish examples and worked proofs of their utterences.
(b) look for repeated claims about that feature and keep them in mind. They could be urban myths, they could be accurate. Just keep them in mind.

Now go and do some tests. Yourself. Otherwise, you just never know…

And this is the nub, I think, of testing. Get some basic information about how it should work, throw in there your experience to date (eg, this AUDIT stuff is putting data into an oracle table, so it is inserting and updating rows in a table, it should react like data going into a normal table. What do I know already about insert and updates to tables?) and ask yourself a few simple questions:-
- How do I think this should work?
- How could this go wrong?
- What scenarios can I think of for using this?
- What are the simplest examples I can think of for this process?
- How can I reduce tests down to trying only this feature or even one aspect of this feature?
- How could this go wrong?
Yep, I ask that last question twice and it is no oversight. I want to try and understand where this new feature might break. I need to ask the “ahh but” questions.